Research

From Snakes to Sequences in 24 Hours: Success!

 

As I type up my notes from the field, I can only imagine what Darwin would think about the advancements in technology used to answer questions about evolutionary biology today...

 

7/11/17 6:00 AM

We hit the ground running after sharing the last post at the airport.  Landing at around 6:00 AM in Quito, Ecuador, we were greeted by our collaborators Lucas Bustamante (Tropical Herping) and Dr. David Salazar (Universidad Indoamerica), threw our gear in the truck, and swung by the University lab to pick up our final crew member, Nicolás Peñafiel. All the equipment and reagents for sequencing appeared to have traveled well on ice packs (at least we hoped so!), so we transferred our frozen material into a cooler and were off to the Chocó rainforest of Ecuador.

The "boat" responsible for transferring our vehicle across the Canandé river

The "boat" responsible for transferring our vehicle across the Canandé river

7/11/17 3:00 PM

After several hours of driving through bumpy jungle roads and crossing the Canandé river on a questionable boat, we arrived at the small lodge nestled in the Chocó rainforest and rendezvoused with the rest of the team, who arrived a couple days ahead of us, including Alejandro Arteaga, Frank Pichardo, and Cesar Barrio Amorós.

Our goal was to survey the region for unique reptiles and amphibians and use the portable laboratory to sequence DNA right there in the field, so no time to waste! Nico and I unpacked the lab equipment and at around 8:24 PM began a few DNA extractions on a whip snake sample using a salt extraction protocol and the DNeasy kit protocol. Then as night fell, we grabbed our headlamps and were out in search of new targets. After several hours spotting numerous frogs and geckos, Frank stumbled upon a gorgeous eyelash viper just off trail.

Eyelash viper posing on the MinION DNA sequencer

Eyelash viper posing on the MinION DNA sequencer

A beautiful shot of our viper next to the MinION by Lucas Bustamante

A beautiful shot of our viper next to the MinION by Lucas Bustamante

7/11/17 11:34 PM

Back at the lodge that evening, we prepped a PCR run using the miniPCR and let it go overnight. Time for some rest.

7/12/17 10:15 AM

While Alejandro took digital white background images of the animals from last night, Nico and I made a gel to visualize the PCR product. The small electrophoresis chamber Nico brought from the lab worked well, but unfortunately my small UV flashlight was unable to really pick up fluorescence in the gel to visualize amplicons. I had tested this out briefly in the US before the trip and was able to pick up bands in a pitch black room, but I think the UV light wasn't quite strong enough under field conditions. Some of the bands appeared to be there which was encouraging, but next time I think it would be beneficial to tinker with a small transilluminator like the one also made by miniPCR.

7/12/17 11:30 AM

Alejandro wrapped up processing his specimens and extracting a small amount of blood or tail tissue from each, so I got to work extracting DNA for the eyelash viper and dwarf geckos. The extraction process with the DNeasy kit is easy (as the name implies!); as for equipment just requires a small centrifuge and the reagents can be stored at room temperature. After about an hour we had our fresh DNA samples.

Part of the DNA extraction and PCR set-up at our field site.

Part of the DNA extraction and PCR set-up at our field site.

1:07 PM

Next I got started with a new round of PCR using primers for genes for 16S, cytb and ND4. These primers don't all necessarily have the same PCR conditions (such as annealing temperature) but for the sake of time and limitations with one miniPCR, I ran them together under the same settings.

3:25 PM

After a couple hours of PCR cycles, it was time for the second PCR barcding step. I used barcodes 1 through 8 for the samples and ran the new PCR protocol.

4:30 PM

Finally, it was time to start the library preparation for the nanopore sequencer using the SQK-LSK 1D kit. This involves the end-prep, adapter ligation and bead cleanup. Next it was time to prime the flow cell and load the sample.

The MinION (top) and miniPCR (bottom) make a great portable duo!

The MinION (top) and miniPCR (bottom) make a great portable duo!

6:24 PM

I clicked "execute" for the MinKNOW software, began the sequencing run and said 'hold on to your butts' (one of my favorite quotes from Jurassic Park).

The MinION sequencer glowing red and blue as it runs off the power of my laptop.

The MinION sequencer glowing red and blue as it runs off the power of my laptop.

Some of the sequence data produced from the MinION sequencer.

Some of the sequence data produced from the MinION sequencer.

7:20 PM

After about an hour, I stopped the run after 16,484 reads had been generated, and ran the data through the Albacore program to demultiplex the reads into their individual barcode folders. I then took a peak in the barcodes and was excited to see the read lengths looked correct, so I downloaded barcode 1 and passed it along to Alejandro's laptop. Barcode 1 was the 16S sequence for the eyelash viper and Alejandro had a nice reference database on his laptop to compare the nanopore sequence to. After a few minutes of tinkering, Ale said "yes, it falls out with Bothriechis schlegelii!". This was it! The nanopore barcode was a complete match to the correct species!

BLAST hit result using a consensus read from the nanopore 16S barcode, which is a 98% match to the correct viper species. It will be interesting to see if the 2% difference is due to individual genetic variation, or if the difference is due to nanop…

BLAST hit result using a consensus read from the nanopore 16S barcode, which is a 98% match to the correct viper species. It will be interesting to see if the 2% difference is due to individual genetic variation, or if the difference is due to nanopore sequence error, which will be verified with Sanger sequencing of the same individual.

Components of the portable lab used on the trip. Left to right: miniPCR sitting atop the Poweradd battery, Vaio laptop with Geneious pro software to visualize sequence data, and the ONT MinION sequencer powered by the laptop.

Components of the portable lab used on the trip. Left to right: miniPCR sitting atop the Poweradd battery, Vaio laptop with Geneious pro software to visualize sequence data, and the ONT MinION sequencer powered by the laptop.

In less than 24 hours from arriving at the field site and sampling snakes and geckos during our first night in the rainforest, we could verify species identification by creating a nanopore consensus and mapping to a pre-downloaded reference database. Now we are also verifying if some species collected are undescribed back at a lab in Quito, and will have everything Sanger sequenced to verify nanopore quality.

9:30 PM

After getting back from the field, Stefan set out to process the reads. While Geneious is good enough for a quick peek, it cannot deal with Nanopore-specific errors. After some quick tests using reference-based mapping (using bwa mem, samtools, angsd and nanopolish) it was clear we got good consensus sequences for all the 16S and the ND4 genes! However, CytB and COI did not amplify, which we verified on a gel back at Quito university a few days later, likely because we didn't have time to run multiple PCRs under optimal contitions for all the genes. Stefan then worked on tweaking de-novo assembly tools such as Canu and Allele Wrangler, to create consensus sequences without reference bias. All sequences from the field were later processed with Canu, which turned out to work pretty well for amplicon assembly.

Stefan working on his nanopore bioinformatics in the jungle.

Stefan working on his nanopore bioinformatics in the jungle.

Overall, we believe this is important becuase the Ecuadorian Chocó is a biodiversity hotspot which has lost more than 98% of habitat due in large part  to logging and palm oil agriculture. Rapid sequencing can be a useful  tool to better understand the diversity of life on our planet and use  that information for conservation. Furthermore, researchers in Quito do not have access to a Sanger sequencer let alone Next Generation Sequencing platforms within the country. Thus, Oxford Nanopore MinION sequencing enables them to rapidly process samples without the need to send them off internationally.

Some of the expedition team members! Left to right: Alejandro, Aaron, Frank and Lucas

Some of the expedition team members! Left to right: Alejandro, Aaron, Frank and Lucas

Right now I'm still feeling a bit of relief and excitement that everything worked in one go in the field. This was an idea that I've been hoping to execute for a while now, and this seemed like the opportune time with a grant funding the project from National Geographic. The work isn't quite done yet, because we are verifying the quality of sequences, performing a few more experiments in lab, and writing all the methods and bioinformatics pipelines up for a publication with our Ecuadorian collaborators. While we quickly and successfully sequenced DNA in the field for correct species identification, this feels like just the beginning!

-Aaron & Stefan

Portable PCR! Testing the miniPCR for DNA sequencing in the field

I've recently been testing portable tools for a project to take the "lab into the field". One interesting little piece of equipment I heard about was the miniPCR, a portable thermocycler that has been used for field PCR experiments, for instance "A simple, economical protocol for DNA extraction and amplification where there is no lab".

miniPCR_me.jpg

I got my hands on one of these little gadgets and put it to the test this week to see if I could amplify genes commonly referred to as DNA "barcodes", which are used for species identification and molecular phylogenetic trees, such as: "Molecular phylogeny of Atractus (Serpentes, Dipsadidae), with emphasis on Ecuadorian species and the description of three new taxa ". This snake paper published by my colleagues in Ecuador utilized partial genes sequences of 16S, cytb, and ND4 genes to generate the snake phylogeny below:

Phylogeny depicting relationships within colubrid snakes of the genus Atractus (Arteaga et al. 2017)

Phylogeny depicting relationships within colubrid snakes of the genus Atractus (Arteaga et al. 2017)

My goal was to perform an experiment with the same DNA sequences as the snake paper using the miniPCR to determine if we can perform amplification of these genes outside of a lab setting. The end goal of the PCR amplification is to feed these sequences into the Oxford Nanopore Technologies (ONT) MinION, a portable gene sequencing machine.

The Oxford Nanopore MinION has a barcoding kit, which allows you to pool amplicons. Each primer used for amplification needs a special "universal tail" adapted beforehand, so I ordered primers for 16S, cytb, ND4, as well as COI with the ONT primer tails as follows:

5’ TTTCTGTTGGTGCTGATATTGC-[project-specific forward primer sequence] 3’

5’ ACTTGCCTGTCGCTCTATCTTC-[project-specific reverse primer sequence] 3’

So for example, the 16S primers looks like this:

16S_F_ONT: TTTCTGTTGGTGCTGATATTGCCGCCTGTTTAYCAAAAACAT

16S_R_ONT: ACTTGCCTGTCGCTCTATCTTCCCGGTCTGAACTCAGATCACGT

Now with the primers and miniPCR in hand, I just needed some snake DNA! Lucky for me, a graduate student colleague in another lab at UC Berkeley had plenty of snake samples to work with (below referred to as "ALS" and "BRK"), so we extracted DNA using a standard salt extraction protocol.

I whipped up a standard mix for a PCR reaction [10X PCR buffer (5 ul), MgCl2 (2 ul), dNTP (1 ul), H2O (~41 ul), Taq (platinum Taq) (0.5 ul)] using primers for 16S, cytb, ND4 and COI and ran the miniPCR under following settings:

To test the "portability" aspect of the miniPCR, I ran it at my apartment powered by an external Poweradd battery.

miniPCR + Poweradd battery = portable PCR combo

miniPCR + Poweradd battery = portable PCR combo

Here are the result of the first PCR run on a gel after a SPRI bead cleanup:

Left to right: two different ladders (1Kb+), ALS 16S (15.8 ng/ul), ALS ND4 (12.6 ng/ul), BRK 16S (10 ng/ul), BRK Cytb (11 ng/ul). The Drosophila (Dmel) COI samples didn't seem to amplify well.

Left to right: two different ladders (1Kb+), ALS 16S (15.8 ng/ul), ALS ND4 (12.6 ng/ul), BRK 16S (10 ng/ul), BRK Cytb (11 ng/ul). The Drosophila (Dmel) COI samples didn't seem to amplify well.

So not bad with the first round of miniPCR! Overall, the lengths on the gel match the expected amplicon length (16S = 585 bp, ND4 = 901 bp, Cytb = 1209 bp). To play it on the safe side, I also had the amplicons sent off to our DNA sequencing facility on campus and confirmed that they were indeed a match to the expected genes. The exception was the Drosophila sample, which interestingly matched to a Drosophila endosymbiotic bacteria (Wolbachia).

Now for the ONT barcode kit, we need to perform one more round of PCR, this time adding the barcode adapters 1 through 12. I made the scheme below to add barcodes to each individual sample of reptile DNA: ALS and BRK (both reptile species from my colleague at Berkeley) as well as some insect samples Plodia (moth), Junonia (butterfly) from our lab, and a Junonia collected form Peru.

Barcode 1: ALS 16S

Barcode 2: ALS ND4

Barcode 3: BRK 16S

Barcode 4: BRK Cytb

Barcode 5: ALS Cytb

Barcode 6: BRK ND4

Barcode 7: Plodia COI

Barcode 8: Junonia Lab COI

Barcode 9: Junonia Peru COI

Barcode 10: ALS 16S + ALS ND4

Barcode 11: BRK 16S + Junonia Lab COI

Barcode 12: Plodia COI + Junonia Lab COI

The second PCR reaction looked like this: Barcode adapter (2ul), PCR DNA template, H2O (44-47 ul), PCR Master Mix (50 ul) and I let the miniPCR do its thing again:

And some of the gel results:

ALS 16S Barcode 1 (152 ng/ul), ALS ND4 Barcode 2 (156 ng/ul), BRK 16s Barcode 3 (168 ng/ul), BRK Cytb Barcode 4 (157 ng/ul)

ALS 16S Barcode 1 (152 ng/ul), ALS ND4 Barcode 2 (156 ng/ul), BRK 16s Barcode 3 (168 ng/ul), BRK Cytb Barcode 4 (157 ng/ul)

So overall, I'm impressed with the miniPCR! It has been consistent and reliable in producing expected amplicons - all within the confines of my apartment kitchen! The Poweradd battery works well to make the miniPCR portable, and each run seems to use ~20-30% of the battery.

The next step involves pooling these barcoded amplicons and sequencing on the MinION, which I have recently done but will dedicate a whole post to the sequencing and analysis next. Stay tuned!

-Aaron

 

 

We Discovered & Published a New Butterfly Life History

FIGURE-5-Adult-Adelotypa-annulifera-putative-wing-pattern-mimicry.jpg

It was late 2014 when Phil Torres first showed me the photos from his recent trip to the Peruvian Amazon. Among them were amazing images of the tropical wildlife, from brilliant macaws to elusive pumas. But there were a few critters in that album that stood out to us in particular. Flipping through his camera, Phil said something to the effect of, "Check out this butterfly dude, it hangs out with ants on bamboo."

A walk through the woods in the Tambopata Amazon Rainforest can turn into a discovery of a never-before-seen behavior! Aaron Pomerantz (@nextgenscientist) and I (@phil_torres) collaborated on project to solve the mystery behind this incredible butterfly. Huge thanks to http://www.perunature.com for supporting our research, go visit Tambopata and see this butterfly for yourself!

You can watch the video Phil and I put together on this discovery

After Phil showed me a few more photos, it was clear that this butterfly-ant interaction was not due to chance...something was going on here.

Multiple butterflies (both male and female) gathering on a bamboo stalk in the presence of ants.

Up-close shot of the butterflies and ants feeding from the sap secretions emitting from the bamboo shoot.

Phil and I both have backgrounds in entomology, and yet we had never seen anything like this before. I mean sure, we knew that some butterfly larvae have symbiotic relationships with ants, known as myrmecophily. This is well documented, as many of the caterpillars that associate with ants have special organs that secrete sugars and amino acids. The ants get a sugary nutritious meal from the caterpillars and, in return, the fragile caterpillars get personal ant bodyguards which defend against predators and parasites. But this is not the case for the adult butterflies, which usually have to evade ants, lest they become their next meal.

One more thing, Phil said, "Look at the three red spots on the butterfly wing. Kind of looks like the ants they're with on the bamboo. Maybe it's some sort of mimicry."

Alright, now I was really interested. The butterfly appears to be a known species, Adelotypa annulifera, but these pictures could be revealing an undocumented observation for this butterfly interacting with ants and a potentially new wing-mimicry pattern. Super cool, I thought, but there was just one problem: we know little about this butterfly beyond some dead pinned specimens. What is its life cycle? Where do the larvae develop? What do the larvae even look like? In other words, next to nothing was known about the life history of this butterfly. So to solve this mystery, Phil and I decided to collaborate. I was making a return trip to this exact field site in the coming months, so I set out to uncover the missing pieces of this puzzle.

Overlook of the Tambopata River at our field site in Southeastern Peru.

Overlook of the Tambopata River at our field site in Southeastern Peru.

The challenge with this type of fieldwork is that the Amazon rainforest is very big, and the critters we are looking for are very small. Since Phil observed the butterflies on bamboo, I ventured out to the same habitat, a trek from the Tambopata Research Center. I recall the jungle seemed particularly hot, humid, rainy, and muddy during that expedition, but I was determined to find our caterpillars and butterflies.

After hours of hiking through the Peruvian Amazon and getting continuously soaked by rain downpours, I found myself in the bamboo forest where we knew our butterflies liked to hang out. After checking dozens of bamboo plants, things seemed futile, as I wasn't finding any signs of our butterflies of interest. But persistence is the key to field work. I then saw a young bamboo shoot poking out of the mud, and noticed a leaf near the base of the bamboo, close to the ground.

Bamboo stalk with a leaf wrapped around the shoot near the base of the plant.

Bamboo stalk with a leaf wrapped around the shoot near the base of the plant.

I pulled the leaf back and to my utter shock, found myself staring directly at two caterpillars nestled against the bamboo, and an agitated ant hovering over the Lepidoptera larvae. My heart was pounding - did I really just find our caterpillars in this vast rainforest!? Clearly they were myrmecophilous, as the ant was trying to protect them.

First observation of the caterpillars with an ant bodyguard.

First observation of the caterpillars with an ant bodyguard.

Although excited from the find, I knew the job wasn't done. This could be any species of caterpillar, so I knew I had to watch them turn into pupae and finally into adults in order to truly confirm that these belonged to the same butterfly species. I continuously checked up on the caterpillars at this spot and took numerous photos and video. After a couple of days, I found our little critters in the same location, but this time they had transformed into pupae! At this point, I gently collected them and brought them to a small insect cage at the Tambopata Research Center to see if they would emerge as butterflies. I had my fingers crossed, hopefully they would survive to adulthood.

The caterpillars later turned into pupae.

The caterpillars later turned into pupae.

Fast forward, and one day I walked past the little insect cage when I noticed some activity. Wings fluttering. One of the pupae had successfully eclosed! So the moment of truth, what butterfly was it? My jaw dropped when I noticed it was, in fact, the same butterfly (Adelotypa annulifera) that Phil had taken pictures of previously. What this means is, we had just completed the entire life cycle of the butterfly, from egg to larvae to pupae, and finally adult. We now felt that we had enough material to write this up as an official scientific publication.

Figure 1 from the publication, the immature life stages of the butterfly and their association with ants. (A) Eggs with Megalomyrmex ant, (B) First instar larva with Ectatomma tuberculatum ant (C) Mid-instar larva with Pheidole ant (D) Mid-instar la…

Figure 1 from the publication, the immature life stages of the butterfly and their association with ants. (A) Eggs with Megalomyrmex ant, (B) First instar larva with Ectatomma tuberculatum ant (C) Mid-instar larva with Pheidole ant (D) Mid-instar larvae with bullet ants (E) Final instar larva with E. tuberculatum ant (E) Pupae.

Figure 2. Dorsal (left) and lateral (right) views of early instar caterpillar.

 

 

 

 

 

Figure 3. Final instar larva (left) and pupa (right).

 

 

 

 

 

Figure 4. Adult Adelotypa annulifera interactions with ants on bamboo. (A) Ants touching the butterfly wings with antennae. (B) Ant crawling on butterfly wing. (C) Ants touching butterfly abdomen. (D-E) Butterflies and ants utilizing extrafloral nec…

Figure 4. Adult Adelotypa annulifera interactions with ants on bamboo. (A) Ants touching the butterfly wings with antennae. (B) Ant crawling on butterfly wing. (C) Ants touching butterfly abdomen. (D-E) Butterflies and ants utilizing extrafloral nectary resources on bamboo. (F) Butterfly drinking bamboo fluid from the ant.

Figure 5. The butterflies and their putative wing pattern mimicry. (A) male butterfly (left) and female butterfly (right) perched on bamboo shoot in presence of red ants. Views of the wing pattern (B) ventral (C) dorsal and (D) lateral.

Overall, it was really exciting collaborating with Phil to discover and publish this life history, which is completely new for this genus of butterflies. In addition, we think the fact that butterflies steal a resource from the ants and let the ants crawl all over them indicates that some complex chemical signaling is going on. Perhaps the butterflies are utilizing a pheromone from their larval stage, potentially allowing the butterfly to take advantage of the ants, which would normally tear a fragile butterfly to shreds. The three red spots on the butterfly wing also look strikingly like the red ants (at least to us) and perhaps serve as a form of mimicry (if a butterfly looks like red ants that bite and sting, a bird may be less inclined to eat it). However, it should be noted that these are just our hypotheses at the moment and, like any hypothesis, should be rigorously tested before we can claim to back it up. We hope to do so, because there most certainly seems to be more to this incredible tropical butterfly than meets the eyes. Stay tuned...

Phil and I enjoying a boat ride along the river in the Amazon rainforest.

For more info, you can download the PDF here: Torres_Pomerantz_Adelotypa_Publication_2016

One more fun fact: it was actually during this trip that I accidentally discovered a totally new, yet unrelated, butterfly-ant relationship. The jungle is full of endless surprises -

[embed]https://www.youtube.com/watch?v=Z1a4zIjo3uU[/embed]

Mystery of the Yellow Bulbs, video and blog post http://blog.perunature.com/2015/11/mystery-of-yellow-bulbs-discovery-of.html

-Aaron

My Instagram: @NextGenScientist & Twitter: @AaronPomerantz

Phil's Instagram: @phil_torres & Twitter: @phil_torres