oxford nanopore technologies

Exploring extreme microbes in Antarctica with extremely fast sequencing technology

On January 14, 2023, I had the opportunity to visit Antarctica with a cohort of invited speakers for an event called ‘Congreso Futuro’ in Chile. For the excursion, I teamed up with another scientist, Matías Gutiérrez, to perform ultra-fast DNA sequencing on-site, using entirely portable laboratory equipment. The objective was to demonstrate that it was possible to collect a small amount of the Antarctic soil and begin sequencing genetic information of the microbes present within the environment, all in less than one hour.

Holding up the portable ‘MinION Mk1C’ device in Antarctica. The screen shows a live interface of the DNA sequencing taking place right then and there.

Upon arrival, we managed to analyze environmental samples associated with moss and lichen, which we collected near the Professor Julio Escudero base of the Chilean Antarctic Institute. Historically, an experiment like this could take several weeks from sample collection in a remote area to analysis in a molecular biology laboratory. Obtaining the answers to research questions in extreme places like Antarctica allows scientists to investigate and ask new questions while still there.

Matías Gutiérrez explained “This is a great milestone given that it is the first time that such rapid sequencing has been carried out in the Chilean Antarctic, but also and perhaps more important is demonstrating that any Chilean scientist can study the genetics of any biological sample, anywhere and at any time. Carrying out this sequencing in the Chilean Antarctic is a powerful testimony to the potential of this technology.”

Moss and lichens native to Antarctica. Life can not only survive in this extreme environment, it can thrive.

Why might we care about microbes that live in Antarctica? Well, no doubt Antarctica is an extreme environment. But life can still thrive here. Scientists investigate these organisms to unlock the secrets of their adaptations, such as the ability to survive incredibly cold temperatures and high levels of radiation, and we believe nanopore sequencing is a powerful tool in this toolkit to improve access to genomics and explore life on earth.

However, time is not on our side. In light of climate change, we must seek to speed up the process of scientific inquiry and make access to tools more equitable. Especially in remote regions of the planet like Antarctica, where we have probably only scratched the surface of biodiversity. This is where miniaturized and accessible sequencing technology can play a critical role, serving as a powerful tool that improves access to genomics and enables scientists around the world to obtain their own DNA sequencing devices and explore life on Earth. Even in places as remote as Antarctica.

Aaron and Matias showcasing the live DNA sequencing run, which was initiated within one hour of collecting samples in Antarctica.

The following week during the official Congreso Futuro event, the President of Chile, Gabriel Boric, hosted guest speakers one evening. While there, we had the opportunity to meet President Boric, discussed the potential of democratizing genomics, and introduced him to the portable MinION device. He was incredibly impressed by the technology and the implications of accessible DNA sequencing, especially for biodiversity and science education. During the event, President Boric noted that Chile’s 2023 budget features a 13.3 percent increase in science investment, a sign that his administration “has the conviction that science and knowledge are the pillar of our development.”

The President of Chile holding the MinION device

Finally, on Friday January 20, I delivered our invited speaker presentation, which was live streamed with >20,000 views, and the recordings are on YouTube. I’ve linked the portion of my presentation which starts at ~3:27:22 in and goes until 3:43:57 here: https://www.youtube.com/live/2hfcow4EhXo?feature=share&t=12442

Presenting at Congreso Futuro on the topic of ‘Democratizing genomics, from the Amazon to Antarctica and beyond’

The main theme of the talk was centered around how we are experiencing a revolution in our ability to obtain and understand biological information like never before, and this is in part because the tools to acquire this information, especially the information of the genome, are becoming more accessible than ever before.

We are all familiar with how computing has evolved, from what initially started out as large and complicated devices that were inaccessible to the majority. In contrast, we’re all quite aware how this has changed - we all have cell phones in our pockets now, and this has fundamentally changed our lives, especially by giving us access to digital information like never before.

Similarly, DNA sequencing technologies have also evolved. What started out as very large and expensive devices, that were relegated to a few institutions that could access these tools. But we’ve come a long way since then, and indeed we’ve also gotten to the point now where these devices for DNA sequencing can be used in the lab and even out in the field. We are beginning to realize the potential of “enabling the analysis of anything, by anyone, anywhere.“

We are thankful for the invitation and opportunity to participate in Congreso Futuro, and would like to also acknowledge the Chilean Antarctic Institute (INACH) and the Chilean Armed Forces for logistical and field support to Antarctica.

Portable PCR! Testing the miniPCR for DNA sequencing in the field

I've recently been testing portable tools for a project to take the "lab into the field". One interesting little piece of equipment I heard about was the miniPCR, a portable thermocycler that has been used for field PCR experiments, for instance "A simple, economical protocol for DNA extraction and amplification where there is no lab".

miniPCR_me.jpg

I got my hands on one of these little gadgets and put it to the test this week to see if I could amplify genes commonly referred to as DNA "barcodes", which are used for species identification and molecular phylogenetic trees, such as: "Molecular phylogeny of Atractus (Serpentes, Dipsadidae), with emphasis on Ecuadorian species and the description of three new taxa ". This snake paper published by my colleagues in Ecuador utilized partial genes sequences of 16S, cytb, and ND4 genes to generate the snake phylogeny below:

Phylogeny depicting relationships within colubrid snakes of the genus Atractus (Arteaga et al. 2017)

Phylogeny depicting relationships within colubrid snakes of the genus Atractus (Arteaga et al. 2017)

My goal was to perform an experiment with the same DNA sequences as the snake paper using the miniPCR to determine if we can perform amplification of these genes outside of a lab setting. The end goal of the PCR amplification is to feed these sequences into the Oxford Nanopore Technologies (ONT) MinION, a portable gene sequencing machine.

The Oxford Nanopore MinION has a barcoding kit, which allows you to pool amplicons. Each primer used for amplification needs a special "universal tail" adapted beforehand, so I ordered primers for 16S, cytb, ND4, as well as COI with the ONT primer tails as follows:

5’ TTTCTGTTGGTGCTGATATTGC-[project-specific forward primer sequence] 3’

5’ ACTTGCCTGTCGCTCTATCTTC-[project-specific reverse primer sequence] 3’

So for example, the 16S primers looks like this:

16S_F_ONT: TTTCTGTTGGTGCTGATATTGCCGCCTGTTTAYCAAAAACAT

16S_R_ONT: ACTTGCCTGTCGCTCTATCTTCCCGGTCTGAACTCAGATCACGT

Now with the primers and miniPCR in hand, I just needed some snake DNA! Lucky for me, a graduate student colleague in another lab at UC Berkeley had plenty of snake samples to work with (below referred to as "ALS" and "BRK"), so we extracted DNA using a standard salt extraction protocol.

I whipped up a standard mix for a PCR reaction [10X PCR buffer (5 ul), MgCl2 (2 ul), dNTP (1 ul), H2O (~41 ul), Taq (platinum Taq) (0.5 ul)] using primers for 16S, cytb, ND4 and COI and ran the miniPCR under following settings:

To test the "portability" aspect of the miniPCR, I ran it at my apartment powered by an external Poweradd battery.

miniPCR + Poweradd battery = portable PCR combo

miniPCR + Poweradd battery = portable PCR combo

Here are the result of the first PCR run on a gel after a SPRI bead cleanup:

Left to right: two different ladders (1Kb+), ALS 16S (15.8 ng/ul), ALS ND4 (12.6 ng/ul), BRK 16S (10 ng/ul), BRK Cytb (11 ng/ul). The Drosophila (Dmel) COI samples didn't seem to amplify well.

Left to right: two different ladders (1Kb+), ALS 16S (15.8 ng/ul), ALS ND4 (12.6 ng/ul), BRK 16S (10 ng/ul), BRK Cytb (11 ng/ul). The Drosophila (Dmel) COI samples didn't seem to amplify well.

So not bad with the first round of miniPCR! Overall, the lengths on the gel match the expected amplicon length (16S = 585 bp, ND4 = 901 bp, Cytb = 1209 bp). To play it on the safe side, I also had the amplicons sent off to our DNA sequencing facility on campus and confirmed that they were indeed a match to the expected genes. The exception was the Drosophila sample, which interestingly matched to a Drosophila endosymbiotic bacteria (Wolbachia).

Now for the ONT barcode kit, we need to perform one more round of PCR, this time adding the barcode adapters 1 through 12. I made the scheme below to add barcodes to each individual sample of reptile DNA: ALS and BRK (both reptile species from my colleague at Berkeley) as well as some insect samples Plodia (moth), Junonia (butterfly) from our lab, and a Junonia collected form Peru.

Barcode 1: ALS 16S

Barcode 2: ALS ND4

Barcode 3: BRK 16S

Barcode 4: BRK Cytb

Barcode 5: ALS Cytb

Barcode 6: BRK ND4

Barcode 7: Plodia COI

Barcode 8: Junonia Lab COI

Barcode 9: Junonia Peru COI

Barcode 10: ALS 16S + ALS ND4

Barcode 11: BRK 16S + Junonia Lab COI

Barcode 12: Plodia COI + Junonia Lab COI

The second PCR reaction looked like this: Barcode adapter (2ul), PCR DNA template, H2O (44-47 ul), PCR Master Mix (50 ul) and I let the miniPCR do its thing again:

And some of the gel results:

ALS 16S Barcode 1 (152 ng/ul), ALS ND4 Barcode 2 (156 ng/ul), BRK 16s Barcode 3 (168 ng/ul), BRK Cytb Barcode 4 (157 ng/ul)

ALS 16S Barcode 1 (152 ng/ul), ALS ND4 Barcode 2 (156 ng/ul), BRK 16s Barcode 3 (168 ng/ul), BRK Cytb Barcode 4 (157 ng/ul)

So overall, I'm impressed with the miniPCR! It has been consistent and reliable in producing expected amplicons - all within the confines of my apartment kitchen! The Poweradd battery works well to make the miniPCR portable, and each run seems to use ~20-30% of the battery.

The next step involves pooling these barcoded amplicons and sequencing on the MinION, which I have recently done but will dedicate a whole post to the sequencing and analysis next. Stay tuned!

-Aaron